Anti-ssDNA/dsDNA [m3D8], Mouse IgG1 kappa, Purified

Catalog Number Pack Size List Price* Quantity
Ab00347-1.1 200 μg 440,00 Add
Ab00347-1.1-BT 1 mg 1'796,00 Add

* CHF, excl. 7.7% VAT and shipping costs

Product Description

Original species and isotype/format: Mouse IgG1

Category Antibody
Supplier Absolute Antibody
Application EL, Other, SPR
Regulatory Status RUO
Research Field DNA hydrolysis, Catalytic Antibody
Immunogen 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Host Ms
Clone Number [m3D8]
Isotype IgG1,k
Clonality Recombi
Format PBS with 0.02% Proclin 300.
Purity Purified
Conjugation Unconjugated
Storage Conditions Store at 4⁰C for up to 3 months. For longer storage, aliquot and store at -20⁰C.
Tech. Data Sheet View datasheet
Link To Supplier
Shipping Details Wet Ice
Material Safety Data Sheet Download PDF