Anti-ssDNA/dsDNA [m3D8], Mouse IgG1 kappa, Purified
Catalog Number | Pack Size | List Price* | Quantity | |
---|---|---|---|---|
Ab00347-1.1 | 200 μg | 550,00 | Add | |
Ab00347-1.1-BT | 1 mg | 2'170,00 | Add |
* CHF, excl. 8.1% VAT and shipping costs
Product Description
Original species and isotype/format: Mouse IgG1
Category | Antibody |
Supplier | Absolute Antibody |
Application | EL, Other, SPR |
Regulatory Status | RUO |
Research Field | DNA hydrolysis, Catalytic Antibody |
Immunogen | 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC |
Host | Ms |
Clone Number | [m3D8] |
Isotype | IgG1,k |
Clonality | Recombi |
Format | PBS with 0.02% Proclin 300. |
Purity | Purified |
Conjugation | Unconjugated |
Storage Conditions | Store at 4⁰C for up to 3 months. For longer storage, aliquot and store at -20⁰C. |
Tech. Data Sheet | View datasheet |
Link To Supplier | http://absoluteantibody.com |
Shipping Details | Wet Ice |
Material Safety Data Sheet | Download PDF |