Anti-ssDNA/dsDNA [m3D8], Mouse Fab fragment kappa, His-Tagged on heavy chain, Purified
| Catalog Number | Pack Size | List Price* | Quantity | |
|---|---|---|---|---|
| Ab00347-1.6 | 200 μg | 630,00 | Add | |
| Ab00347-1.6-BT | 1 mg | 2'507,00 | Add |
* CHF, excl. 8.1% VAT and shipping costs
Product Description
Original species and isotype/format: Mouse IgG1
| Category | Antibody |
| Supplier | Absolute Antibody |
| Application | EL, Other, SPR |
| Regulatory Status | RUO |
| Research Field | DNA hydrolysis, Catalytic Antibody |
| Immunogen | 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC |
| Host | Ms |
| Clone Number | [m3D8] |
| Isotype | Fab,k |
| Clonality | Recombi |
| Format | PBS with 0.02% Proclin 300. |
| Purity | Purified |
| Conjugation | Unconjugated |
| Storage Conditions | Store at 4⁰C for up to 3 months. For longer storage, aliquot and store at -20⁰C. |
| Tech. Data Sheet | View datasheet |
| Link To Supplier | http://absoluteantibody.com |
| Shipping Details | Wet Ice |
| Material Safety Data Sheet | Download PDF |
